Sections
Personal tools
You are here: Home » Tutorials » bio-knoppix Tutorial
Views

bio-knoppix Tutorial

A very, very short tutorial on bio-knoppix

A short intro to bio-knoppix

Humberto Ortiz Zuazaga & Carlos Rodriguez

{humberto|carlos}@hpcf.upr.edu

Outline

  • Why bio-knoppix?
  • Booting bio-knoppix
  • knoppix is linux is UNIX
  • Tools on the CD
  • EMBOSS
  • Sequence file formats
  • Errata

bio-knoppix

Carlos's custom version of KNOPPIX, a live-cd version of Debian GNU/linux. Debian is free software, software you are allowed to modify and redistribute.

Contact the HPCf for more information on bio-knoppix, or see www.debian.org and www.gnu.org for more information on debian and free software.

Booting bio-knoppix

Place the CD and reboot the computer. Some machines require changing the BIOS options to boot from the CD. As a last resort, there is also a floppy image on the CD that you may use to boot the PC.

When you log out of KNOPPIX, the CD ejects automatically.

UNIX

bio-knoppix has menus, icons, and a desktop. Most work will be done in a "shell" window. The icon has a picture of a sea shell.

  • ls - LiSt files
  • cp - CoPy files
  • man - Read MANuals

Most unix tasks can also be accomplished via the menus and icons.

UNIX tutorials:

Tools in bio-knoppix

  • EMBOSS - European Molecular Biology Open Software Suite
  • Artemis - free genome browser and annotation tool.
  • ImageJ - NIH sponsored image processing tool

EMBOSS

  • European Molecular Biology Open Software Suite
  • more than 100 free tools for molecular biology
  • written with the express purpose of remaining non-commercial
  • Online, free tutorials, examples, manuals,...
  • See EMBOSS website, tutorial, ...

EMBOSS tools

  • Sequence alignment
  • Rapid database searching with sequence patterns
  • Protein motif identification, including domain analysis
  • Nucleotide sequence pattern analysis, for example to identify CpG islands or repeats.
  • Codon usage analysis for small genomes
  • Rapid identification of sequence patterns in large scale sequence sets.
  • Presentation tools for publication
  • more...

EMBOSS Introduction

The program wossname searches for EMBOSS programs by keyword:

  $ wossname abi
  Finds programs by keywords in their one-line documentation
  SEARCH FOR 'ABI'
  abiview          Reads ABI file and display the trace

The Fine Manual

The program tfm reads a program manual:

  $ tfm abiview
  Displays a program's help documentation manual

                                  abiview 

  Function

   Reads ABI file and display the trace

  Description

   abiview reads in an ABI sequence trace file and graphically displays
   the results.

Sequence formats

  • Chromatograms .abi, .scf
  • Sequence: Fasta, GenBank, GCG, ...
  • Multiple sequence: clustal, MSF, nexus, phylip
  • Phylogeny new jersey tree format
  • Structure .pdb

Abiview

Example abiview output

IUPAC Nucleotide Codes

IUPAC Nucleotide codes

Amino acid codes

IUPAC Amino acid codes

B, Z , and X are IUPAC ambiguity codes. Selenocysteine (U) is the 21st amino acid. See online resources.

Sequence retrieval

Add seqret slide here.

Fasta format

Fasta is a common file format:

  >XLRHODOP L07770.1 Xenopus laevis rhodopsin mRNA, complete cds.
  ggtagaacagcttcagttgggatcacaggcttctagggatcctttgggcaaaaaagaaac
  acagaaggcattctttctatacaagaaaggactttatagagctgctaccatgaacggaac
  agaaggtccaaatttttatgtccccatgtccaacaaaactggggtggtacgaagcccatt

GenBank flatfile format

Text file format for GenBank:

  LOCUS       XELRHODOP               1684 bp    mRNA    linear   VRT 15-FEB-1996
  DEFINITION  Xenopus laevis rhodopsin mRNA, complete cds.
  ACCESSION   L07770
  VERSION     L07770.1  GI:214734
  KEYWORDS    G protein-coupled receptor; phototransduction protein; retinal
              protein; rhodopsin; transmembrane protein.
  SOURCE      Xenopus laevis (African clawed frog)
    ORGANISM  Xenopus laevis
              Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
              Amphibia; Batrachia; Anura; Mesobatrachia; Pipoidea; Pipidae;
              Xenopodinae; Xenopus.
  REFERENCE   1  (bases 1 to 1684)
    AUTHORS   Knox,B.E., Scalzetti,L.C., Batni,S. and Wang,J.Q.
    TITLE     Molecular cloning of the abundant rhodopsin and transducin from
              Xenopus laevis
    JOURNAL   Unpublished (1992)
  REFERENCE   2  (bases 1 to 1684)
    AUTHORS   Batni,S., Scalzetti,L., Moody,S.A. and Knox,B.E.
    TITLE     Characterization of the Xenopus rhodopsin gene
    JOURNAL   J. Biol. Chem. 271 (6), 3179-3186 (1996)
    MEDLINE   96216396
     PUBMED   8621718

Errata

  • When following the tutorial, add the letter t to all sequence database names (tembl, tsp, tgenbank, ...)
  • Before running dottup type:
        export PLPLOT_LIB=/usr/local/share/EMBOSS
    
Created by humberto
Last modified 2004-09-07 07:26 AM
bioknoppix Home Page
What you think about the new bioknoppix web page?
Very good
Good
So, so
Bad
Very bad

[ Results | Polls ]
Votes : 755
« August 2008 »
Su Mo Tu We Th Fr Sa
          1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
31            
 
 

Powered by Plone

This site conforms to the following standards: