A short intro to bio-knoppix

Humberto Ortiz Zuazaga & Carlos Rodriguez

{humberto|carlos}@hpcf.upr.edu

Outline

• Why bio-knoppix?
• Booting bio-knoppix
• knoppix is linux is UNIX
• Tools on the CD
• EMBOSS
• Sequence file formats
• Errata

bio-knoppix

Carlos's custom version of KNOPPIX, a live-cd version of Debian GNU/linux. Debian is free software, software you are allowed to modify and redistribute.

Contact the HPCf for more information on bio-knoppix, or see www.debian.org and www.gnu.org for more information on debian and free software.

Booting bio-knoppix

Place the CD and reboot the computer. Some machines require changing the BIOS options to boot from the CD. As a last resort, there is also a floppy image on the CD that you may use to boot the PC.

When you log out of KNOPPIX, the CD ejects automatically.

UNIX

bio-knoppix has menus, icons, and a desktop. Most work will be done in a "shell" window. The icon has a picture of a sea shell.

• ls - LiSt files
• cp - CoPy files
• man - Read MANuals

Most unix tasks can also be accomplished via the menus and icons.

UNIX tutorials:

• UPR-RUM Math UNIX course
• Surrey College (UK) Unix tutorial

Tools in bio-knoppix

• EMBOSS - European Molecular Biology Open Software Suite
• Artemis - free genome browser and annotation tool.
• ImageJ - NIH sponsored image processing tool

EMBOSS

• European Molecular Biology Open Software Suite
• more than 100 free tools for molecular biology
• written with the express purpose of remaining non-commercial
• Online, free tutorials, examples, manuals,...
• See EMBOSS website, tutorial, ...

EMBOSS tools

• Sequence alignment
• Rapid database searching with sequence patterns
• Protein motif identification, including domain analysis
• Nucleotide sequence pattern analysis, for example to identify CpG islands or repeats.
• Codon usage analysis for small genomes
• Rapid identification of sequence patterns in large scale sequence sets.
• Presentation tools for publication
• more...

EMBOSS Introduction

The program wossname searches for EMBOSS programs by keyword:

  $ wossname abi
  Finds programs by keywords in their one-line documentation
  SEARCH FOR 'ABI'
  abiview          Reads ABI file and display the trace

The Fine Manual

The program tfm reads a program manual:

  $ tfm abiview
  Displays a program's help documentation manual

                                  abiview 

  Function

   Reads ABI file and display the trace

  Description

   abiview reads in an ABI sequence trace file and graphically displays
   the results.

Sequence formats

• Chromatograms .abi, .scf
• Sequence: Fasta, GenBank, GCG, ...
• Multiple sequence: clustal, MSF, nexus, phylip
• Phylogeny new jersey tree format
• Structure .pdb

Abiview

IUPAC Nucleotide Codes

IUPAC Nucleotide codes

Amino acid codes

IUPAC Amino acid codes

B, Z , and X are IUPAC ambiguity codes. Selenocysteine (U) is the 21st amino acid. See online resources.

Sequence retrieval

Add seqret slide here.

Fasta format

Fasta is a common file format:

  >XLRHODOP L07770.1 Xenopus laevis rhodopsin mRNA, complete cds.
  ggtagaacagcttcagttgggatcacaggcttctagggatcctttgggcaaaaaagaaac
  acagaaggcattctttctatacaagaaaggactttatagagctgctaccatgaacggaac
  agaaggtccaaatttttatgtccccatgtccaacaaaactggggtggtacgaagcccatt

GenBank flatfile format

Text file format for GenBank:

  LOCUS       XELRHODOP               1684 bp    mRNA    linear   VRT 15-FEB-1996
  DEFINITION  Xenopus laevis rhodopsin mRNA, complete cds.
  ACCESSION   L07770
  VERSION     L07770.1  GI:214734
  KEYWORDS    G protein-coupled receptor; phototransduction protein; retinal
              protein; rhodopsin; transmembrane protein.
  SOURCE      Xenopus laevis (African clawed frog)
    ORGANISM  Xenopus laevis
              Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
              Amphibia; Batrachia; Anura; Mesobatrachia; Pipoidea; Pipidae;
              Xenopodinae; Xenopus.
  REFERENCE   1  (bases 1 to 1684)
    AUTHORS   Knox,B.E., Scalzetti,L.C., Batni,S. and Wang,J.Q.
    TITLE     Molecular cloning of the abundant rhodopsin and transducin from
              Xenopus laevis
    JOURNAL   Unpublished (1992)
  REFERENCE   2  (bases 1 to 1684)
    AUTHORS   Batni,S., Scalzetti,L., Moody,S.A. and Knox,B.E.
    TITLE     Characterization of the Xenopus rhodopsin gene
    JOURNAL   J. Biol. Chem. 271 (6), 3179-3186 (1996)
    MEDLINE   96216396
     PUBMED   8621718

Errata

• When following the tutorial, add the letter t to all sequence database names (tembl, tsp, tgenbank, ...)
• Before running dottup type:

      export PLPLOT_LIB=/usr/local/share/EMBOSS